The cellranger mkvdjref tool can be used to generate a custom reference package from a genome sequence FASTA file and a gene annotation GTF.

Copy
$ cellranger mkvdjref --genome=my_vdj_ref \
                      --fasta=GRCh38_ensembl.fasta \
                      --genes=GRCh38_ensembl.gtf

A Cell Ranger V(D)J reference consists of germline gene segment sequences. It assumes that these sequences are contained within a genome reference FASTA, and that an Ensembl-formatted gene annotation GTF points to the relevant gene segments.

The cellranger mkvdjref tool expects a FASTA file (supplied by the --fasta argument) containing genomic reference sequences whose names are consistent with the names used in the GTF file.

The cellranger vdj pipeline expects a GTF file (supplied by the --genes argument) in an Ensembl-like format that contains information about V(D)J gene segments.

GTF columns

| Column | Name | Description |

| ------ | ------------ | -------|

| 1 | Chromosome | Must refer to a chromosome/contig in the genome fasta. | | 2 | Source | Unused. | | 3 | Feature | Cell Ranger vdj only uses rows where this line is equal to one of CDS or five_prime_utr. | | 4 | Start | Start position on the reference (1-based inclusive). | | 5 | End | End position on the reference (1-based inclusive). | | 6 | Score | Unused. | | 7 | Strand | Strandedness of this feature on the reference: + or -. | | 8 | Frame | Unused. | | 9 | Attributes | A semicolon-delimited list of key-value pairs of the form key "value". The attribute keys used by Cell Ranger V(D)J are detailed below. |

GTF attributes

| GTF Attribute | Description |

| --- | --- |

| transcript_id | Becomes the record_id in the Cell Ranger V(D)J reference entry format. | | transcript_biotype | The value is used to infer the V(D)J segment type. Either transcript_biotype or gene_biotype must be a value in the "Accepted Biotypes" list below. If transcript_biotype is not on the accepted list, then gene_biotype is used. | | gene_biotype | See transcript_biotype.
| gene_name | Must be specified. Becomes the gene_name in the Cell Ranger V(D)J reference entry format. |

Accepted biotypes

• TR_C_gene
• TR_D_gene
• TR_J_gene
• TR_V_gene
• IG_C_gene
• IG_D_gene
• IG_J_gene
• IG_V_gene

Example minimal GTF row used by cellranger vdj

Copy
14      havana  CDS     21621904        21621946        .       +       0       transcript_id "ENST00000542354"; gene_name "TRAV1-1"; transcript_biotype "TR_V_gene";

A successful cellranger mkvdjref run creates a directory whose named is specified by the --genome argument.

Copy
$ tree my_vdj_ref

my_vdj_ref
        ├── fasta
        │   └── regions.fa
        └── reference.json

The regions.fa is the V(D)J segment FASTA file. The header (first) line contains V(D)J-specific metadata. The feature_id and display_name are feature-specific identifier fields (see table). All other fields describe the V(D)J feature.

Copy
>feature_id|display_name record_id|gene_name|region_type|chain_type|chain|isotype|allele_name

SEQUENCE

Examples

Copy
>1|TRAV1*01 AF259072|TRAV1|L-REGION+V-REGION|TR|TRA|None|01
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
>979|IGHA*01 J00475|IGHA|C-REGION|IG|IGH|A|01
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT

You can directly generate a FASTA file in the segment format and create a V(D)J reference by passing this file to cellranger mkvdjref with the --seqs argument, for example:

Copy
$ cellranger mkvdjref --genome=my_vdj_ref \
                      --seq=custom_segments.fasta

Cell Ranger comes with the fetch-imgt script that downloads the relevant sequences from IMGT and generates a V(D)J segment FASTA file. The V(D)J segment FASTA file can subsequently be used to construct a V(D)J reference package.

The instructions for creating IMGT references have been tested only for human and mouse species. If you are working with other species, it is advisable to validate your IMGT references. To get started, refer to the Knowledge Base article titled Building a custom reference for V(D)J using IMGT tool.

This example generates a mouse V(D)J reference based on IMGT.

Copy
# source the environment of CellRanger 7.1.0 for your shell (bash/csh)
# (for bash shell)
source path/to/cellranger-7.1.0/sourceme.bash
# OR (for C shell)
source path/to/cellranger-7.1.0/sourceme.csh


echo "version checks"
python --version



# Using a script that comes with Cell Ranger, get data from IMGT and create a FASTA suitable for use by mkvdjref

# The option --species is the name of the species for which the data is to be downloaded.

# The option --genome provides the prefix used to name the 2 output files. Only the file with suffix -mkvdjref-input.fasta is used as input to the mkvdjref utility.

path/to/cellranger-7.1.0/lib/bin/fetch-imgt --genome vdj_IMGT_mouse --species "Mus musculus"


# Build the CR reference. could also include Cell Ranger on your PATH to avoid specifying the full path for cellranger.

# The option --genome is a single identifier with no special symbols aside from hyphen or underscore. The reference will be placed in a directory created with that name.

# The option --seqs is the mkvdjref-input.fasta file generated by the fetch-imgt command.

path/to/cellranger-7.1.0/cellranger mkvdjref --genome=vdj_IMGT_mouse --seqs=vdj_IMGT_mouse-mkvdjref-input.fasta